The Study of Granular Sludge by Fluorescent In Situ Hybridization
Richard Bridges
Sludge is a biomass of microorganisms that is basically waste matter eating away at itself. The densest form of sludge is known as sludge granules. These granules can consists of up to ninety percent microbes that are packed together very tightly. Granular sludge is a very complex microbial community, with many of the microbes that make up these granules still not known. The study of the organisms that make up granular sludge face the same problems encountered by other areas of microbiology that studied diversity.
One of the biggest obstacles faced when studying extremely diverse microbial cultures is the difficulty to culture and isolate the bacteria. In the past a microbiologist’s studies were based mainly on what he could successfully cultivate (1). The uses of techniques such as viable plate counts are not considered adequate for these types of studies. It has also been well stated that direct microscope counts are usually greater than viable cell counts by severed orders of magnitude (1). The culturability of samples from different habitats can range from as low as 0.001% in saltwater to as high as 0.25% in fresh water and sediments (1).
To solve this problem scientist started taking a molecular approach to identifying bacteria. The target of their analysis was RNA. The first studies of RNA for phylogenetic analysis started with the 5S, RNA molecules. Since this molecule is only approximately 120 nucleotides long, the amount of information was limited. Researchers then began to look at the 16S, RNA molecule, which has a length of approximately 1600 nucleotides. Took such as PCR and clone libraries led to the ability sequence these segments. Once databases of sequences had been developed, comparisons between 16S, RNA sequences and DNA sequences of organisms could be compared (1).
One of the techniques to come out of RNA analysis was in situ hybridization. This is a technique that uses labeled oligonuceotide probes that target rRNA. In situ hybridization can be used to study such factors as whole cell morphology, counting, and identifying of single cell bacteria (1). In situ hybridization has proven itself to be an invaluable tool in determinative, phylogenetic, and environmental studies in microbiology (1).
The literature is rich in examples of in situ hybridization with fluorescent probes. Solving problems that could not as easily have been done through traditional culture dependent methods. One study done on activated sludge samples from aeration tanks. These were studies with fluorescent probes. Through FISH they were able to determine that the sludge samples were dominated by proteobacteria, which took up approximately 80% of all active bacteria found in the sludge. The probes allowed for the classification of isolates and to directly monitor population shifts in the media (3). Using FISH can allow for monitoring a certain species in activated sludge (4). FISH can often be used in combination with other equipment such as a confocal scanning microscope (10) and flow cytometry (2). The use of these can expound FISH even more. FISH and confocal laser scanning were used to reveal the spatial organizations of methanogens and uncultivated bacteria and their in situ morphologies and metabolic functions in both mesophillic and thermophillic sludge granules (10). In another experiment the oligonucleotide probes were used to measure the changes in the levels of precursor rRNA in activated sludge systems (8).
The first step in the FISH process is to design oligonucleotide probes with fluorescent labels to paint stretches of DNA or RNA. The probes are allowed to hybridize with the complementary nucleic acids. The fluorescent tags can then be viewed. This is usually done with a scanning laser microscope. FISH can be used on both dividing and non-dividing cells. There are two types of non-radioactive hybridization, direct and indirect. In the direct method, the detectable molecule (the reporter) is bound directly to the nucleic acid probe. This allows for the probe/target hybrids to be viewed immediately after the hybridization reaction. The indirect method requires a probe that contains a reporter molecule that can be detected by affinity cytochemistry.
The process of studying granular sludge through Fluorescent In-situ Hybridization (FISH) follows a general order. The first phase is collection of granular sludge, this usually done by taking samples from some sort of wastewater treatment facility. Sludge granule samples are collected from the reactors where they are eating away at waste matter. These samples can then be fixed for study or loaded into small laboratory reactors. Bacteria can be fixed with 3% paraformaldehyde and then stored in 50% ethanol in phosphate-buffered saline (PBS) (2). Instead of fixing bacteria, samples can be loaded into laboratory USAB reactors. The reactors are then fed with mineral mediums and the granules continue to exist in a smaller environment (5). These reactors can be kept going until the samples are needed.
The next phase in the process is the fixation, embedding, and sectioning of the sludge granules. Fresh granule samples, either directly from the wastewater treatment facility or from an inoculated lab reactor, must be gently washed with water or allowed to settle. The granules were then fixed with paraformaldehyde in PBS (5). The cell concentrations in the buffer are kept at the same level (6). After granules have been prepared they are added to melted paraplast. This mixture is allowed to cool for sectioning. The Paraplast-sludge granule cubes are cut with a conventional microtomic. The sections are cut in thicknesses between 5 and 10 microns. This range is used because sections that are thinner than 5 microns are too brittle and sections that are over 10 microns thick tend to generate too much background. These sections are stretched in 50-degree water and transferred to slides. The slides are then dried overnight at 42°C. The slides are then deparafinated in xylol for 30 minutes, and the xylol was removed by rinsing the slides with a mixture of xylol-TBA-ethanol. These slides can then be stored in a dry box for up to 6 months at 4°C(5).
The third major phase is the probes. Probes must be designed to target certain sequences. The sequences are usually areas in the 16sRNA region.
Table 1. Examples of Oligonucleotide Probes
EUB338
GCTGCCTCCCGTAGGAGT
bacteria
Bond et al.
ALF1B
CGTTCG (C/T)TCTGAGCCAG
alpha proteobacteria
“
BET42a
GCCTTCCCACTTCGTTT
beta proteobacteria
“
BONE23a
GAATTCCATACCCCCTCT
beta 1 subgroup proteobacteria
“
BTWO23A
GAATTCCACCCCCCTCT
competitor of BONE23a
“
GAM42a
GCCTTCCCACATCGTTT
gamma proteobacteria
“
HGC69a
TATAGTTACCACCGCCGT
Actinobacteria
“
EUK
ACCAGACTTGCCCTCC
Eukarya
Wallner
et al.
ACA
ATCCTCTCCCATACTCTA
Actinobacteria
“
MG1200
CGGATAATTCGGGGCATGCTG
Methanomicrobiales
Sekiguchi et al.
MB1174
TACCGTCGTCCACTCCTTCCTC
Methanosarcinaceae
“
MS1414
CTCACCCATACCTCACTCGGG
Methanosarcinaceae
“
MX825
TCGCACCGTGGCCGACACCTAGC
Methanosaetaceae
“
D660
GAATTCCACTTTCCCCTCTG
Desulfobulbus
“
MS1
CCGGATAAGTCTCTTGA
Methanosaeta concilii
Rocheleau et al.
MS2
CTGAATGAGAGCGCTTTCTTT
“
“
MS5
GGCCACGGGTGCGACCGTTGTCG
“
“
MX825(38)
TCGCAACCGTGGCCCGACACCTAGC
“
“
MB1
TTTGGTCAGTCCTCCGG
Methanosarcina barkeri
“
MB3
CCAGACTTGGAACCG
“
“
MB4
TTTATGCGTAAAATGGATT
“
“
MS821(38)
CGCCATGCCTGACACCTAGGCCAGC “
“
MG3
CTCCTTGCACACACCGCCC
Mesophillic methanogens
“
UNIV1392
ACGGGCGGTGTGTRC
Universal
“
ARCH915
GTGCTCCCCCGCCAATTCCT
Archaea
Snaidr et al.
CF319a
TGGTCCGTGTCTCAGTAC
Cytophaga-flavobacterium
“
HGC69a
TATAGTTACCACCGCCGT
Gram + w/ high G-C
“
AER66
CTACTTTCCCGCTGCCGC
Aermonas spp.
“
LDI23a
CTCTGCCGCACTCCAGCT
beta subgroup of proteobacter
“
ARC94
TGCGCCACTTAGCTGACA
Arcobacter species
“
Oligonucleotide probes were synthesized and labeled on the 5’ end with a fluorescent labels such as FLUOS (a fluorescin derivative) or rhodamine. These can be purified by gel electrophoresis (5). In-situ hybridization would then be performed in hybridization buffer (6). After hybridization excess probe is removed by washing with hybridization buffer for about 30 minutes. Next they would be rinsed in water and air-dried. The slides would then be viewed under an epifluorescence microscope or a confocal scanning microscope (5).
There has been much data collected in the area of granular sludge by the use of fluorescent in situ hybridization. FISH has been used mainly to determine the diversity of the bacterial communities in the sludge granules. FISH has also been used to determine the positioning of bacteria throughout the sludge granule. Understanding of this biology can lead to better use of sludge granules in the business of wastewater treatment.
Fluorescent in situ hybridization experiments were first done in conjunction with other molecular techniques in the study of sludge granules. In 1993 Wagner et al. used FISH to show the inadequacy of culture dependent methods. They used probes that were complementary to conserved regions of the rRNA of the alpha, beta, and gamma subclasses of Proteobacteria and of all bacteria to study sludge granules. FISH probes allowed them to rapidly count, classify the isolates, and to directly monitor population shifts in nutrient amended activated sludge (3). Wagner et al. in 1994 studied Actinetobacter species through FISH monitoring. Again they used probes specific for Actinetobacter species, the alpha, beta, and gamma subclasses of Proteobacter, the cytophaga-flavobacterium cluster, high G-C content Gram-positive bacteria, and for all bacteria. They then performed total cell counts of both aerobic and anaerobic basins of sewage treatment plants. This study found that Actinobacter species constituted less than 10% of all bacteria in both aerobic and anaerobic basins. This result was interesting because it had been thought that enhanced biological phosphate removal, an important concern in wastewater treatment, in both aerobic and anaerobic sludge was due to members of the Actinetobacter species (4). Other studies dealing with phosphate removal have shown that beta-proteobacter is very important in phosphate removal along with Actinobacter (14).
Fluorescent in situ hybridization can be used in conjunction with other techniques to increase the efficiency and the amount of information derived from the study of sludge granules. FISH can be combined with flow cytometry to create a tool for rapid and highly automated analysis of bacterial communities in activated sludge. Wallner et al. showed that this combination can work very well together. This method had previously been used only on cultured cells. Since the cells in the sludge granules are in a very rich environment they have very high cellular ribosome contents and give bright hybridization signals. Their work showed that as many as 70-80% of the Hoechst 33342-stained cells showed probe-conferred fluorescence above background level. This also means that somewhere between 20-30% of cells were not able to be identified by this method. However, the percentage of identifiable cells is much higher than in culture dependent methods, which detect only 1-15% (2). Fluorescent in situ hybridization can also be used in conjunction with microautoradiography. This was demonstrated by Lee et al (Lee 1999). Another useful tool with FISH is confocal laser scanning laser microscopy (11).
Now that FISH had been shown to be a very useful tool in the study of sludge granules, researchers began to use it to determine not only cell counts and percentages but also localization. Harmsen et al. used FISH to study the organization of bacteria in sludge granules. They used 2 laboratory scale upflow anaerobic sludge blanket reactors. One reactor was fed with sucrose and one was fed with a mixture of volatile fatty acids. The work showed that sucrose fed granules was made up of three layers. The exterior layer was made up of general bacteria. The second layer had syntrophic microcolonies mixed with microcolonies of Methanosaeta species. The central region had large cavities, anorganic materials, and a few methanogen microcolonies. The sludge granules that were fed with volatile fatty acids showed one extra layer under the outer layer, which contained large quantities of Methanosaeta species (5). Sekiguchi et al. also did similar research on sludge granules. They used FISH to study the localization of methanogens and selected uncultured bacteria in mesophilic and thermophilic sludge granules. Both mesophilic and thermophilic granules showed a similar structure. The outer layers were primarily made up of bacteria and inner layers made up of archaeal cells. They both had large non-staining centers where neither bacterial nor archaeal cells could be found. They found that the dominant member of the archaeal layer was of the genus Methanosaeta. Major bacterial species found were of the Desulfobulbus, Syntrophobacter, Methanobacteria, and green non-sulfur bacteria (10). Similar results were reported by Imachi et al. During this study they were able to use FISH to search for a non-sulfate-reducing microorganism phylogenetically close to the Desulfotomaculum group. They were able to find this organism and determine its spatial distribution (13).
Further work continued with the phylogenetic analysis of sludge granules from wastewater treatment plants. Snaidr et al. showed that 41% of identifiable bacterial cells hybridized with probes specific for beta subclass of Proteobacteria, 8% with probes specific for alpha subclass, and 12% with probes for gamma subclass. The cytophaga-flavobacterium group was found at 12%, and a probe for high G-C bacteria bound at 13% (6).
The use of FISH in sludge granule work began to get more specific in its aim. Researchers began looking at more specific types of bacteria in the sludge granule. One reason for looking at specific types of bacteria in sludge granules is that problems often occur in the treatment facilities. One of these problems is known as foaming episodes. Foaming episodes can cause problems ranging from reduced efficiency to health problems from wind blown foam. One bacteria thought to be involved in the episodes is Gordona amarae. De los Reyes et al. designed probes for G. amarae and two subgroups within the species. They found these strains in the foam and the levels of these bacteria can be quantified through the use of FISH (7).
Fluorescent in situ hybridization techniques also allowed for such things as monitoring of bacterial communities in sludge granules. By designing probes specific for rRNA, one can study specific species in sludge granules. An example of this is the monitoring of precursor 16S rRNAs of Actinetobacter species in wastewater. It was proposed that by combining both probes for precursor 16S rRNA and mature 16S rRNA population size and in situ growth activity can be monitored (8). This technique would allow one to study the growth phase of a particular bacteria in the sludge granule. This is useful when one is trying to understand or prevent problems in wastewater treatment facilities. FISH has also been used to detect bacteria in sludge granules that can carry out certain physiological processes that could not be detected by other methods. Schram et al. were able to detect sulfate-reducing bacteria even though no other testing methods could find the reduction of sulfate. They were also able to find nitrate-reducing bacteria, event though no nitrate reduction could be found (9). Rocheleau et al. were able to use FISH to differentiate between Methanosaeta concilii and Methanosarcina barkeri in anaerobic mesophilic granular sludge. By designing probes for these two bacteria, they were able to identify and localize the two types of bacteria. FISH was also used for the quantification of the two species (10).
Fluorescent in situ hybridization has proven itself to be a very useful tool in the study of sludge granules from wastewater treatment facilities. It has allowed researchers to study sludge granules in a way that culture dependent techniques did not allow. When FISH is combined with other techniques such as confocal laser scanning microscopy, flow cytometry, and microautoradiography its uses become even wider. FISH with these other tools allows for identification, localization, and quantification, of bacteria in sludge granules from wastewater treatment facilities.
As far as FISH has come, it is possible for the technique to give us even more information. By using FISH to study the types of bacteria in the sludge it will be possible to develop a better understanding of the communities in them and how they work together. This would allow wastewater treatment facilities to “engineer” sludge granules to be more efficient. Studies of the bacteria found in sludge granules could lead to finding the genes the make certain bacteria good at breaking down waste products. This would allow bacterial genomes to be altered in a way that allowed for the development of bacteria that could be used in environmental cleanup.